Skip to content

MonashBioinformaticsPlatform/trimviz

Repository files navigation

Trimviz

Visualisation of trimming or soft-clipping of short sequence reads

For help and dependencies:

python ./trimviz.py -h


Quickstart:

Set-up

In the folder where you want to place trimviz:

git clone https://github.com/MonashBioinformaticsPlatform/trimviz

optional: If you don't want to manually install the dependencies, import the trimviz conda environment:

./trimviz/setup.sh
conda activate trimViz2025_renv

This will also set up renv to manage the R dependencies.


Running:

Note: -k argument can speed up analysis of large files and remove the seqtk requirement


fastq-fastq comparison (trimming analysis):

python path/to/trimviz.py FQ -o tv_outdir -u untrimmed_R1.fastq.gz -t trimmed_R1.fastq.gz

Example report - FQ mode


fastq-bam comparison (soft-clipping analysis):

python path/to/trimviz.py SC -o tv_outdir -p pre_aligned_R1.fastq.gz -b aligned.bam -g path/to/reference_fasta.fa

Example report - SC mode


fastq-fastq comparison (trimming analysis) with downstream alignment context in diff mode and adapter highlighting:

python path/to/trimviz.py FQ -o tv_outdir -u untrimmed_R1.fastq.gz -t trimmed_R1.fastq.gz -b aligned.bam -g path/to/reference_fasta.fa -d -a AGATCGGAAGAGCACACGTCTGAAC

Example report - FQ mode + bam


Problematic read-2 dataset: soft-clipping analysis with diff mode:

python path/to/trimviz.py SC -o tv_outdir -P pre_aligned_R2.fastq.gz -b aligned.bam -g path/to/reference_fasta.fa -d

Example report - SC mode + diff display

The above analysis suggests a problem with the original sequence data (41,250 of 50,000 reads were 3'-soft-clipped by the aligner). The input fastq had already been trimmed for quality and adapter sequences. However the last 4 bp still almost never aligned with the reference, suggesting that they originated elsewhere.


Command-line arguments:

Trimviz takes a random sample of untrimmed reads from a fastq file, looks up the same reads in a trimmed fastq file and visualises the trimmed reads with respect to surrounding base call quality values and adapter sequence. In soft-clipping mode, Trimviz will instead visualize the soft-clipping of reads by an aligner.

Note on paired-end reads: if the fastq files are Read 2 files, use -U/-T/-P instead of -u/-t/-p so that trimviz knows to extract the Read 2 alignment from the bam file.

Usage:

    ./trimviz.py FQ -o/-O output_dir -u/-U untrimmed.fq.gz -t/-T trimmed.fq.gz [ -b align.bam -g reference.fa ]
    ./trimviz.py SC -o/-O output_dir -p/-P prealignment.fq.gz -b align.bam -g reference.fa
    
    trimviz.py FQ        Fastq-fastq comparison. Bam file and genome fasta file can be optionally given to view the mapping outcomes for trimmed reads.
    trimviz.py SC        Treat soft clipping as the trimming of interest. Bam and genome fasta file are required, with only one fastq file.
    
    options:
    -o/--out_dir          Directory for output. If it already exists, an error will be generated. Report will be out_dir/trimvis_report.html
    -O/--out_dir_fat      Directory for output + temporary files. Choose this option to keep the sub-sampled fastq files.
    -u/--untrimmed_R1     FQ mode: untrimmed Read 1 fastq file. 
    -t/--trimmed_R1       FQ mode: trimmed Read 1 fastq file.
    -U/--untrimmed_R2     FQ mode: untrimmed Read 2 fastq file.
    -T/--trimmed_R2       FQ mode: trimmed Read 2 fastq file.
    -p/--prealign_R1      SC mode: Read 1 fastq file input into the aligner, which may or may not have been trimmed prior to alignment.
    -P/--prealign_R2      SC mode: Read 2 fastq file input into the aligner, which may or may not have been trimmed prior to alignment.
    -b/--bam              Bam file (optional in FQ mode; required in SC mode).
    -g/--genome_fasta     Fasta file of genome sequence (required if using .bam alignment)
    -c/--classes          [uncut,3pcut,removed,5pcut] Comma-separated trim-classes to visualise in individual read visualisation.
                          One/several of 'uncut','5pcut','3pcut','removed','generated_warning','indel'
    -a/--adapt:           comma-separated adapter sequences to highlight (multiple adapters not supported yet - defaults to first adapter in list)
    -A/--adaptfile        Text file containing adapter sequences (multiple adapters not supported yet - defaults to first adapter in list)
    -n/--sample_size      [50000] internal parameter: max reads to subsample in file (should be >> -w and -v, especially if only a small proportion are trimmed)
    -v/--nvis             [20] number of reads in each category (or in total if -R is set) to use for detailed individual plots
    -w/--heatmap_reads    [200] number of reads to plot in heatmaps
    -f/--agg_flank        [20] number of flanking nucleotides around trim point to plot in heatmaps 
    -r/--rid_file         File of read-ids to select, instead of using random sampling
    -s/--rseed            [1] random seed for sampling
    -k/--skim             [-1] Speed up by skimming the reads from the tops of the fastq files (warning: these will be edge-of-flowcell reads).
                          The argument is the number of reads to skip before sampling -n reads. The fastq files must be in the same order. 
    
    flags:
    -R/--representative   Ignore read-classes and take a representative sample. (This often results in untrimmed reads dominating the 1-by-1 visualization)
    -z/--gzipped          Assume fastq files are gzipped (default behaviour is to guess via .gz file extension)
    -e/--read2only        (Not yet implemented) Extract Read-2 alignments from the .bam file. Ignored unless both R1 and R2 files are given.
    -d/--diff             When displaying genomic alignment context from bam file, only display nucleotides that differ from the read sequence
    -q/--quiet_mode       Do not warn about ambiguously clipped reads (they will still be counted as 'ambigious' in the summary however).
    -x/--exclude_ambig    Exclude ambiguously clipped reads from visualisations (they will still be counted as 'ambigious' in the summary however).
    -h/--help:            Print this help page

    Requires:
    Rscript
    seqtk (except in -k mode)
    samtools (if using bam files as input)
    Python-2 libraries:
    getopt, subprocess, random, re, sys, os, gzip, pysam (if using bam files as input), and pipes (for older python3 versions)
    R libraries:
    ggplot2, ape, reshape2, gridExtra, renv (renv alone can manage the other libraries: it will create a custom renv library inside the trimviz directory)


Dependencies:

Command-line programs:

  • Rscript
  • seqtk (if not using -k)
  • samtools (if input includes bam files)

Python libraries:

  • pysam (if input includes bam files)

R libraries:

These can be automatically loaded via renv if installed.

  • ggplot2
  • ape
  • reshape2
  • gridExtra

Tested with R4.5.2 and Python 3.13.9 (latest)


Installing dependendies:

An example script demonstrating the installation of dependencies using Conda and R-renv is included: trimviz/setup.sh


Trimviz analysis details:

Fastq-fastq mode (FQ): Trimviz takes a random sample of reads from an untrimmed fastq file, looks up the same reads in a trimmed fastq file and visualises the trimming sites with respect to surrounding base call quality values, adapter sequence, and, if a bam file is given, downstream alignment context. Bam file must be the result of aligning the trimmed (-t/-T) fastq file. However Trimviz will look back and extract the genomic region that would have been covered by the entire untrimmed read if it had aligned at the same place, thus it also needs a fasta file of the genome to retrieve some extra flanking sequence. This assists in determining whether the untrimmed reads would have mapped equally well or whether too many errors would be introduced (especially with --diff mode).

Soft-clipping mode (SC): Trimviz will visualize the soft-clipping sites of reads that occurs during alignment to a reference genome. This works similar to above except the bam file is treated like a trimmed fastq file. The bam file must be the result of direct alignment of the (-p/-P) fastq file, which may or may not have been trimmed prior to alignment.


Usually, for a small fraction of reads, the trimmed sequence aligns to multiple positions within the untrimmed counterpart and these reads are output as warnings.


Explanation of output:

Trimviz classifies reads into 4 categories: 'uncut', '3pcut' (ie. 3' trimmed), '5pcut' (ie. 5' trimmed), 'removed' (ie. filtered reads in FQ mode; unmapped reads in SC mode) by comparison between pre- and post- trimmed fastq files (or between a fastq file and a bam file in SC mode). Trimviz randomly samples reads from the entire fastq file, thus it has to stream though 2 or 3 large files and may take some time to complete - or you can just skim the top of the fastq files with the -k argument, as long as the read-order is the same. It can accept fastq-files that were output from any trimming tool.

The Trimviz report written to out_dir/trimvis_report.html includes:

  1. Table of the number of reads falling into each of the above read trimming categories.
  2. Read-trimming profiles for a) 3'-trimmed and b) 5'-trimmed reads, if any. Gives a zoomed-out overview of where reads were trimmed in each trimming category.
  3. Sequence and base-quality heatmaps for reads, anchored around a) 3'-trimming sites and b) 5'-trimming sites, if any. Adapter sequences are usually seen as large blocks of identical sequence after clustering. Other problems such as low mappability or inclusion of poor-quality bases can be seen.
  4. 1-by-1 visualisations of trimmed reads from each category. By default, Trimviz attempts to visualise roughly equal numbers of the 4 main trimming/clipping classes.

Collectively, these visualizations give an idea as to the primary drivers of trimming by the trimming tool or aligner (e.g. adapter-trimming vs quality-trimming) and can help diagnose problems such as leftover adapter sequences, over- or under- trimming, and even reference assembly issues.



About

Visualisation of trimming or soft-clipping of short sequence reads

Resources

Stars

Watchers

Forks

Releases

Packages

Contributors

Languages